Normalmente el perfil de ADN se emplea para identificar a sospechosos de un crimen o restos humanos, o para resolver casos que parecían no tener solución. Pero, a veces el perfil de ADN funciona y otras veces no. ¿Por qué sucede esto? Aquí te lo explicamos.

El perfil de ADN empezó a usarse en el sistema judicial penal desde la década de los 80, pero se lo conoce con ese nombre desde 1994. Originalmente se identificó al proceso como «huellas dactilares de ADN».

El ADN puede ser 99,9% idéntico en todos los seres humanos. Pero, el 98% del ADN de nuestras células no tienen una relación con los genes. A este se le llama ADN no codificante y este estaría conformado por secuencias de las cuatro bases que componen el ADN de cada célula. Algunas de esas secciones se repiten, como por ejemplo TCTATTCTATCTATCTATCTA, donde la secuencia TCTA se repite cinco veces. Esta secuencia puede ser constante en una persona y variar en otras.

Los perfiles de ADN se basan en detectar las repeticiones y estarían conformados por una lista de números, basada en las secuencias repetidas.

¿Cómo se hace un perfil de ADN?

En 1994, el Servicio de Ciencias Forenses del Reino Unido empezó a usar las secuencias repetidas cortas o «repetición corta en tándem» (STR). En ese entonces, la probabilidad de que dos personas en la población compartiesen los mismos números repetidos en estas cuatro regiones era de aproximadamente 1 en 50 000.

Actualmente, la probabilidad de que dos personas tengan el mismo perfil de ADN es mínima, debido al uso de todas las regiones STR conocidas.

Vía Depositphotos.

Para realizar el perfil, se debe recurrir a una muestra de sangre, tejido, saliva o cabello. Luego, esa muestra se coloca en un tubo con un cóctel de productos químicos que purifica el ADN del resto del material celular. Posteriormente se cuantifica la cantidad de ADN.

Si hay suficiente ADN presente en la muestra, se proseguirá a generar el perfil de ADN. La cantidad óptima para hacerlo es de solo 500 picogramos, el equivalente a 80 células.

¿Por qué a veces no funciona?

A veces el perfil de ADN puede funcionar y a veces no. La infalibilidad del perfil de ADN dependerá de que los datos del ADN estén completos. Puede suceder que la cantidad de la muestra de ADN es inferior a la óptima o esta contiene ADN de dos personas distintas, por lo tanto, el perfil de ADN será una mezcla de los dos ADN.

Para separar los perfiles mixtos de ADN se emplean varios tipos de software. Pero cuando el ADN está incompleto o parcial, con menos datos de ADN, será difícil identificar a la persona.

Cuando ya se tiene un perfil de una muestra, este se compara con un perfil de referencia, que puede ser el tomado de un testigo, personas de interés o bases de datos criminales de ADN.

También se puede averiguar el sexo biológico del dueño de la muestra con el perfil de ADN STR estándar. Pero, este no puede decir mucho más sobre la apariencia de la persona, ni siquiera sobre su ascendencia.

A pesar de sus limitaciones, esta prueba forense sigue siendo muy poderosa para conocer el dueño de un material biológico específico.

Referencias:

DNA is often used in solving crimes. But how does DNA profiling actually work?: https://theconversation.com/dna-is-often-used-in-solving-crimes-but-how-does-dna-profiling-actually-work-191937

DNA is often used in solving crimes. But how does DNA profiling actually work?: https://phys.org/news/2022-10-dna-crimes-profiling.html

Deja un comentario

Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *